Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #28025)


Item Catalog # Description Quantity Price (USD)
Plasmid 28025 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4300
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    KEAP1 (a.k.a. INrf2, KLHL19)
  • Tag / Fusion Protein
    • hrGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CAGCTGACCAGCCTGGGCAAG
  • 3′ sequencing primer TAATACGACTCACTATAGGG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hrGFP-Keap1 was a gift from Qing Zhong (Addgene plasmid # 28025 ; ; RRID:Addgene_28025)
  • For your References section:

    Keap1 facilitates p62-mediated ubiquitin aggregate clearance via autophagy. Fan W, Tang Z, Chen D, Moughon D, Ding X, Chen S, Zhu M, Zhong Q. Autophagy. 2010 Jul 22. 6(5):. 10.4161/auto.6.5.12189 PubMed 20495340