REST corepressor 2_R (OZ554)
(Plasmid #28079)

Loading...
Available to Academic and Nonprofits Only

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Growth instructions
    Requires a bacterial strain such as XL1 Blue, that expresses the lacIq allele of lac repressor
  • Copy number
    Low Copy

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.

Gene/Insert

  • Gene/Insert name
    Zinc finger array targeting REST corepressor 2
  • Alt name
    rcor2
  • Alt name
    REST corepressor 2
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    270
  • GenBank ID
    ENSDARG00000008278
  • Entrez Gene
    rcor2 (a.k.a. MGC77264, zgc:77264)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer OK.61 GGGTAGTACGATGACGGAACCTGTC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

This plasmid encodes a zinc finger array targeting half of a target sequence in the zebrafish gene REST corepressor 2 (see below). Please note that this plasmid does NOT contain the REST corepressor 2 sequence.

Users must order the complementary plasmid REST corepressor 2_L (OZ553) [Addgene plasmid 28078] in order to create a zinc finger nuclease (ZFN) pair to introduce targeted mutations into this specific zebrafish gene.

Users will also need to clone the zinc finger (ZF) insert of this plasmid into a zinc finger nuclease (ZFN) vector to express a FOKI fusion product. Examples of possible ZFN expression vectors that can be used are: pST1374 (Addgene plasmid 13426), pMLM290 (Addgene plasmid 21872), pMLM292 (Addgene plasmid 21873), pMLM800 (Addgene plasmid 27202) and pMLM802 (Addgene plasmid 27203).

This zinc finger array was tested for binding activity to the sequence 5'-TGCGATGGA-3' in a bacterial two hybrid assay, and resulted in 6.66 fold activation. However, this array has not yet been tested for activity as a zinc finger nuclease (i.e. for its ability to induce mutations at the intended locus).

Scientists using this zinc finger array in a publication should notify zebrafishzfs@zincfingers.org and acknowledge NIH grant number R01 GM088040 in the publication.

Other Articles: "Oligomerized pool engineering (OPEN): an 'open-source' protocol for making customized zinc-finger arrays." Maeder ML et al. (Nat Protoc. 2009 Sept 17. 4(10):1471-1501. Pubmed ID: 19798082

"Targeted mutagenesis in zebrafish using customized zinc-finger nucleases." Foley JE et al. (Nat Protoc. 2009 Dec 3. 4(12):1855-1867. Pubmed ID: 20010934

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    REST corepressor 2_R (OZ554) was a gift from Keith Joung (Addgene plasmid # 28079)
  • For your References section:

    Rapid "open-source" engineering of customized zinc-finger nucleases for highly efficient gene modification. Maeder ML, Thibodeau-Beganny S, Osiak A, Wright DA, Anthony RM, Eichtinger M, Jiang T, Foley JE, Winfrey RJ, Townsend JA, Unger-Wallace E, Sander JD, Muller-Lerch F, Fu F, Pearlberg J, Goebel C, Dassie JP, Pruett-Miller SM, Porteus MH, Sgroi DC, Iafrate AJ, Dobbs D, McCray PB, Cathomen T, Voytas DF, Joung JK. Mol Cell. 2008 Jul 25. 31(2):294-301. 10.1016/j.molcel.2008.06.016 PubMed 18657511