tdp43-EGFP construct8
(Plasmid
#28201)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 28201 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech Laboratories, Inc
- Backbone size w/o insert (bp) 4694
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDH5a in LB media at 37C
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTar DNA binding protein
-
Alt nameTDP43
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1122
-
Mutationaa275-313 deleted
-
GenBank IDNM_007375
-
Entrez GeneTARDBP (a.k.a. ALS10, TDP-43)
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (not destroyed)
- 3′ cloning site BamH1 (not destroyed)
- 5′ sequencing primer AATGGGAGTTTGTTTTGGCA
- 3′ sequencing primer ACGAGGGTGGGCCAGGGCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
tdp43-EGFP construct8 was a gift from Zuoshang Xu (Addgene plasmid # 28201 ; http://n2t.net/addgene:28201 ; RRID:Addgene_28201) -
For your References section:
The C-terminal TDP-43 fragments have a high aggregation propensity and harm neurons by a dominant-negative mechanism. Yang C, Tan W, Whittle C, Qiu L, Cao L, Akbarian S, Xu Z. PLoS One. 2010 . 5(12):e15878. 10.1371/journal.pone.0015878 PubMed 21209826