1
Plasmid 29663: pET His6 GFP TEV LIC cloning vector (1GFP)
  • None

  • His6-GFP-TEV

  • N terminal on backbone

  • pET
    (Search Vector Database)

  • Bacterial Expression

  • 6075

  • The GFP is the version described in Pedelacq et. al. (Jan 2006, Nature Biotechnology). The following mutations are included: F100S, M154T, V164A, S30R, Y39N, N105T, Y145F, I171V and A206K. These mutations have been shown to enhance brightness and solubility, and to inhibit dimerization.

  • LIC tag

  • Yes

  • LIC tag

  • Yes

  • GFP forward (5'cagctcgccgaccacta) List of Sequencing Primers

  • T7 reverse

  • Kanamycin

  • DH5alpha

  • 37

  • Low Copy

  • View sequences (2)
  • View map

  • Scott Gradia

  • UBMTA
    EMD Millipore Limited Use Label License/Brookhaven pET Assurance Letter
    Ancillary Agreement for Plasmids Containing FP Materials

Comments: 

This plasmid is an empty vector to be used with a LIC cloning protocol.

It has a TEV-cleavable His6 fusion tag on its N-terminus. GFP can enhance your protein's expression and solubility. It can also be used as a reporter gene.

To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.

Forward - 5'TACTTCCAATCCAATGCA3'

Reverse - 5'TTATCCACTTCCAATGTTATTA3'

Linearize the plasmid with SspI and gel purify.

When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.

More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 29663" in your Materials and Methods section.