The GFP is the version described in Pedelacq et. al. (Jan 2006, Nature Biotechnology). The following mutations are included: F100S, M154T, V164A, S30R, Y39N, N105T, Y145F, I171V and A206K. These mutations have been shown to enhance brightness and solubility, and to inhibit dimerization.
This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable His6 fusion tag on its N-terminus. GFP can enhance your protein's expression and solubility. It can also be used as a reporter gene.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
Addgene has sequenced a portion of this plasmid for verification.
Click here for the sequencing
result.
Please acknowledge the principal investigator and cite this article if you use
this plasmid in a publication. Also, please include the text "Addgene plasmid
29663" in your Materials and Methods section.
This plasmid is an empty vector to be used with a LIC cloning protocol.
It has a TEV-cleavable His6 fusion tag on its N-terminus. GFP can enhance your protein's expression and solubility. It can also be used as a reporter gene.
To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/