Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pET His6 GFP TEV LIC cloning vector (1GFP)
(Plasmid #29663)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 29663 Standard format: Plasmid sent in bacteria as agar stab 1 $75
Cloning Grade DNA 29663-DNA.cg 2 µg of cloning grade DNA in Tris buffer 1 $95

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET
  • Backbone size (bp) 6075
  • Modifications to backbone
    The GFP is the version described in Pedelacq et. al. (Jan 2006, Nature Biotechnology). The following mutations are included: F100S, M154T, V164A, S30R, Y39N, N105T, Y145F, I171V and A206K. These mutations have been shown to enhance brightness and solubility, and to inhibit dimerization.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    None
  • Tag / Fusion Protein
    • His6-GFP-TEV (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site LIC tag (destroyed during cloning)
  • 3′ cloning site LIC tag (destroyed during cloning)
  • 5′ sequencing primer GFP forward (5'cagctcgccgaccacta)
  • 3′ sequencing primer T7 reverse
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

This plasmid is an empty vector to be used with a LIC cloning protocol.

It has a TEV-cleavable His6 fusion tag on its N-terminus. GFP can enhance your protein's expression and solubility. It can also be used as a reporter gene.

To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers.

Forward - 5'TACTTCCAATCCAATGCA3'

Reverse - 5'TTATCCACTTCCAATGTTATTA3'

Linearize the plasmid with SspI and gel purify.

When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.

More information on this vector can be found through http://qb3.berkeley.edu/macrolab/

Information for Cloning Grade DNA (Catalog # 29663-DNA.cg) ( Back to top )

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

  • Amount 2 µg
  • Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
  • Pricing $95 USD
  • Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).

Resource Information

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET His6 GFP TEV LIC cloning vector (1GFP) was a gift from Scott Gradia (Addgene plasmid # 29663 ; http://n2t.net/addgene:29663 ; RRID:Addgene_29663)