|
Plasmid
29706:
pET His6 MBP N10 TEV LIC cloning vector (2C-T)
|
Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result. Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 29706" in your Materials and Methods section. |
This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.
The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).
2C-T has a TEV-cleavable N-terminal His6-MBP fusion tag. MBP can improve the expression and solubility of your target protein. The N10 linker may help you to avoid steric clashes between your protein and the MBP tag.
To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.
Forward - 5'TACTTCCAATCCAATGCA3'
Reverse - 5'TTATCCACTTCCAATGTTATTA3'
Linearize the plasmid with SspI and gel purify.
When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.
More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/