Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

pET His6 MBP N10 TEV LIC cloning vector (2C-T)
(Plasmid #29706)

Item Catalog # Description Quantity Price (USD)
Plasmid 29706 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy

  • Gene/Insert name
  • Tag / Fusion Protein
    • His6-MBP-N10-TEV (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site LIC site (destroyed during cloning)
  • 3′ cloning site LIC site (destroyed during cloning)
  • 5′ sequencing primer MBP forward (5'ggtcgtcagactgtcgatgaagcc)
  • 3′ sequencing primer T7 reverse
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol. All 2-series vectors work as single-expression vectors, as well as transfer vectors for our polycistronic system.

The LIC cloning site is flanked by 5 pairs of restriction sites, so that your gene can easily be subcloned into our polycistronic destination vectors (2D, 2E, or 2Z).

2C-T has a TEV-cleavable N-terminal His6-MBP fusion tag. MBP can improve the expression and solubility of your target protein. The N10 linker may help you to avoid steric clashes between your protein and the MBP tag.

To clone into this vector, add LIC v1 tags to the 5' end of your PCR primers.

Linearize the plasmid with SspI and gel purify.

When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector.

More information on this vector can be found through

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET His6 MBP N10 TEV LIC cloning vector (2C-T) was a gift from Scott Gradia (Addgene plasmid # 29706)