pET Biotin His6 mCherry LIC cloning vector (H6-mCherry)
(Plasmid #29722)

Available to Academic and Nonprofits Only

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    None
  • Tags / Fusion Proteins
    • Biotin - His6 - TEV (N terminal on backbone)
    • mCherry (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site LIC site vGFP (destroyed during cloning)
  • 3′ cloning site LIC site vGFP (destroyed during cloning)
  • 5′ sequencing primer T7 forward
  • 3′ sequencing primer mCherry reverse (5'gcaccttgaagcgcatgaact)
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol.

mCherry has a excitation max of 587 nm and an emission max of 610 nm.

To clone into this vector, add LIC tags to the 5' end of your PCR primers.

Forward - 5'TACTTCCAATCCAATGCA3'

Reverse - 5'CTCCCACTACCAATGCC 3'

Do NOT include a stop codon with your reverse primer.

Linearize the plasmid with SspI, then gel purify.

When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector.

More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET Biotin His6 mCherry LIC cloning vector (H6-mCherry) was a gift from Scott Gradia (Addgene plasmid # 29722)