1
Plasmid 30185: pET MBP-FlAsH LIC cloning vector (MBP-FlAsH)
  • None

  • FlAsH

  • C terminal on backbone

  • Biotin-H6-MBP-TEV recognition

  • N terminal on backbone

  • pET
    (Search Vector Database)

  • Bacterial Expression

  • 6568

  • LIC site vGFP

  • Yes

  • LIC site vGFP

  • Yes

  • MBP forward (5'ggtcgtcagactgtcgatgaagcc) List of Sequencing Primers

  • T7 reverse

  • Kanamycin

  • DH5alpha

  • 37

  • Low Copy

  • View sequences (3)
  • Scott Gradia

  • MTA
    EMD Millipore Limited Use Label License/Brookhaven pET Assurance Letter

Comments: 

This plasmid is an empty vector. Your gene can be inserted with a LIC cloning protocol.

This vector adds a short FlAsH tag to the C-terminus of your protein. When your protein is mixed with a biarsenical reagent (see Invitrogen's website), fluorescence will develop. This technique may be useful when a larger fusion interferes with the function of your protein.

Additionally, the vector adds an MBP fusion to the N-terminus of your protein, which may help expression and solubility.

To clone into this vector, add LIC tags to the 5' end of your PCR primers.

Forward - 5' TACTTCCAATCCAATGCA3'

Reverse - 5' CTCCCACTACCAATGCC 3'

Do NOT include a stop codon with your reverse primer.

Linearize the plasmid with SspI, then gel purify.

When digesting the DNA with T4 polymerase, use dCTP for the insert and dGTP for your linearized vector.

More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 30185" in your Materials and Methods section.