-
Depositing Labs
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 30317 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCB6
- Backbone size w/o insert (bp) 6189
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameZonula Occludens-1
-
Alt nameTJP1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5364
-
Mutationnone
-
Entrez GeneTJP1 (a.k.a. ZO-1)
-
Tag
/ Fusion Protein
- myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Kpn I (not destroyed)
- 3′ cloning site Xba I (destroyed during cloning)
- 5′ sequencing primer GTTGACGCAAATGGGCGGTAGGC
- 3′ sequencing primer GTCAGACAAAATGATGCAAC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pCB6 expression vector originally from Ann Hubbard, Johns Hopkins University. Contains:
CMV promoter, hGH terminator
SV40 polyA signal
pBR322 ori
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCB6 ZO1myc was a gift from James Anderson & Alan Fanning (Addgene plasmid # 30317 ; http://n2t.net/addgene:30317 ; RRID:Addgene_30317) -
For your References section:
The tight junction protein ZO-1 establishes a link between the transmembrane protein occludin and the actin cytoskeleton. Fanning AS, Jameson BJ, Jesaitis LA, Anderson JM. J Biol Chem. 1998 Nov 6. 273(45):29745-53. 10.1074/jbc.273.45.29745 PubMed 9792688