pCB6 ZO1myc
(Plasmid #30317)

• Depositing Labs: James Anderson, Alan Fanning
• Publication: Fanning et al J Biol Chem. 1998 Nov 6. 273(45):29745-53.

Backbone

• Vector backbone: pCB6
• Backbone size w/o insert (bp): 6189
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Zonula Occludens-1
• Alt name: TJP1
• Species: H. sapiens (human)
• Insert Size (bp): 5364
• Mutation: none
• Entrez Gene: TJP1 (a.k.a. ZO-1)
• Tag / Fusion Protein:
  • myc (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Kpn I (not destroyed)
• 3′ cloning site: Xba I (destroyed during cloning)
• 5′ sequencing primer: GTTGACGCAAATGGGCGGTAGGC
• 3′ sequencing primer: GTCAGACAAAATGATGCAAC

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

pCB6 expression vector originally from Ann Hubbard, Johns Hopkins University. Contains:
CMV promoter, hGH terminator
SV40 polyA signal
pBR322 ori