GFP-PICK
(Plasmid
#31613)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 31613 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneFUGW
-
Backbone manufacturerDavid Baltimore (Caltech)
- Backbone size w/o insert (bp) 9941
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsStbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePICK1 (shRNA insensitive) +shRNA towards PICK1
-
Alt namePICK1
-
SpeciesR. norvegicus (rat)
-
Entrez GenePick1 (a.k.a. Prkcabp)
-
Tags
/ Fusion Proteins
- GFP (N terminal on insert)
- HA (N terminal on insert)
- PICK1 shRNA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer EGFP-C (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This is the replacement construct which expresses an shRNA to knockdown the endogenous protein and a recombinant GFP-tagged, shRNA-resistant protein, to replace the endogenous PICK1.
shRNA sequence: CTATGAGTACCGCCTTATCCT
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-PICK was a gift from Robert Malenka (Addgene plasmid # 31613 ; http://n2t.net/addgene:31613 ; RRID:Addgene_31613) -
For your References section:
Calcium binding to PICK1 is essential for the intracellular retention of AMPA receptors underlying long-term depression. Citri A, Bhattacharyya S, Ma C, Morishita W, Fang S, Rizo J, Malenka RC. J Neurosci. 2010 Dec 8. 30(49):16437-52. 10.1523/JNEUROSCI.4478-10.2010 PubMed 21147983