1
Plasmid 31613: GFP-PICK
  • PICK1 (shRNA insensitive) +shRNA towards PICK1

  • PICK1

  • R. norvegicus (rat)

  • Pick1 (Prkcabp)

  • GFP

  • N terminal on insert

  • HA

  • N terminal on insert

  • PICK1 shRNA

  • N terminal on backbone

  • FUGW
    (Search Vector Database)

  • David Baltimore (Caltech)

  • Mammalian Expression, Lentiviral

  • 9941

  • EGFP-C List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 37

  • Stbl3

  • High Copy

  • View sequences (4)
  • Robert Malenka

  • MTA

Comments: 

This is the replacement construct which expresses an shRNA to knockdown the endogenous protein and a recombinant GFP-tagged, shRNA-resistant protein, to replace the endogenous PICK1.

shRNA sequence: CTATGAGTACCGCCTTATCCT

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Calcium binding to PICK1 is essential for the intracellular retention of AMPA receptors underlying long-term depression. Citri et al (J Neurosci. 2010 Dec 8. 30(49):16437-52. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 31613" in your Materials and Methods section.