1
Plasmid 32400: pLKO.shNkx2-1
  • shRNA targetting Nkx2-1

  • CGCCATGTCTTGTTCTACCTT

  • M. musculus (mouse)

  • Nkx2-1 (AV026640, Nkx2.1, T/EBP, Titf1, Ttf-1)

  • pLKO
    (Search Vector Database)

  • Mammalian Expression, Lentiviral, RNAi

  • To knockdown Nkx2-1 shRNA pLKO.1 lentiviral vectors from TRC targeting Nkx2-1 were used. The best hairpin sequence targeting Nkx2-1 was: shNkx2-1 (TRCN0000086266) 5’ CGCCATGTCTTGTTCTACCTT 3’.

  • AgeI

  • No

  • EcoRI

  • No

  • LKO.1 5' List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Puromycin

  • View sequences (1)
  • Tyler Jacks

  • Monte Winslow

  • UBMTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Suppression of lung adenocarcinoma progression by Nkx2-1. Winslow et al (Nature. 2011 May 5. 473(7345):101-4. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 32400" in your Materials and Methods section.