pLKO.shNkx2-1
(Plasmid #32400)

Loading...
Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pLKO
  • Modifications to backbone
    To knockdown Nkx2-1 shRNA pLKO.1 lentiviral vectors from TRC targeting Nkx2-1 were used. The best hairpin sequence targeting Nkx2-1 was: shNkx2-1 (TRCN0000086266) 5’ CGCCATGTCTTGTTCTACCTT 3’.
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.

Gene/Insert

  • Gene/Insert name
    shRNA targetting Nkx2-1
  • gRNA/shRNA sequence
    CGCCATGTCTTGTTCTACCTT
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Nkx2-1 (a.k.a. AV026640, Nkx2.1, T/EBP, Titf1, Ttf-1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.shNkx2-1 was a gift from Tyler Jacks & Monte Winslow (Addgene plasmid # 32400)
  • For your References section:

    Suppression of lung adenocarcinoma progression by Nkx2-1. Winslow MM, Dayton TL, Verhaak RG, Kim-Kiselak C, Snyder EL, Feldser DM, Hubbard DD, DuPage MJ, Whittaker CA, Hoersch S, Yoon S, Crowley D, Bronson RT, Chiang DY, Meyerson M, Jacks T. Nature. 2011 May 5. 473(7345):101-4. 10.1038/nature09881 PubMed 21471965