This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #32400)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 32400 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Modifications to backbone
    To knockdown Nkx2-1 shRNA pLKO.1 lentiviral vectors from TRC targeting Nkx2-1 were used. The best hairpin sequence targeting Nkx2-1 was: shNkx2-1 (TRCN0000086266) 5’ CGCCATGTCTTGTTCTACCTT 3’.
  • Vector type
    Mammalian Expression, Lentiviral, RNAi
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    shRNA targetting Nkx2-1
  • gRNA/shRNA sequence
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Nkx2-1 (a.k.a. AV026640, Nkx2.1, T/EBP, Titf1, Ttf-1)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer LKO.1 5'
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.shNkx2-1 was a gift from Tyler Jacks & Monte Winslow (Addgene plasmid # 32400)
  • For your References section:

    Suppression of lung adenocarcinoma progression by Nkx2-1. Winslow MM, Dayton TL, Verhaak RG, Kim-Kiselak C, Snyder EL, Feldser DM, Hubbard DD, DuPage MJ, Whittaker CA, Hoersch S, Yoon S, Crowley D, Bronson RT, Chiang DY, Meyerson M, Jacks T. Nature. 2011 May 5. 473(7345):101-4. 10.1038/nature09881 PubMed 21471965