1
Plasmid 33149: pLG-Sty
  • RP51A-synthetic minimal intron

  • S. cerevisiae (budding yeast)

  • RPS17A (YML024W, RP51A, RPL51A)

  • LacZ

  • C terminal on backbone

  • Sty1 site upstream of intron was cut/filled/ligated to change CCATGG to CCATGCATGG

  • pLGSD5
    (Search Vector Database)

  • Yeast Expression

  • BamHI

  • No

  • BamHI

  • No

  • none List of Sequencing Primers

  • LacZ-R

  • Ampicillin

  • TG1

  • 37

  • Unknown

  • URA3

  • View sequences (1)
  • View map

  • View map

  • Michael Rosbash

  • MTA

Comments: 

Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Some cis- and trans-acting mutants for splicing target pre-mRNA to the cytoplasm. Legrain et al (Cell. 1989 May 19;57(4):573-83. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 33149" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only
This is commonly requested with