pLG-Sty
(Plasmid #33149)

Available to Academic and Nonprofits Only

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    TG1
  • Copy number
    Unknown

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.

Gene/Insert

  • Gene/Insert name
    RP51A-synthetic minimal intron
  • Species
    S. cerevisiae (budding yeast)
  • Mutation
    Sty1 site upstream of intron was cut/filled/ligated to change CCATGG to CCATGCATGG
  • Entrez Gene
    RPS17A (a.k.a. YML024W, RP51A, RPL51A)
  • Tag / Fusion Protein
    • LacZ (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer none
  • 3′ sequencing primer LacZ-R
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLG-Sty was a gift from Michael Rosbash (Addgene plasmid # 33149)
  • For your References section:

    Some cis- and trans-acting mutants for splicing target pre-mRNA to the cytoplasm. Legrain P, Rosbash M. Cell. 1989 May 19;57(4):573-83. 10.1016/0092-8674(89)90127-X PubMed 2655924