pYFJ16-LplA(W37V) (for E. Coli expression)
(Plasmid #34838)

• Depositing Lab: Alice Ting
• Publication: Uttamapinant et al Proc Natl Acad Sci U S A. 2010 Jun 15. 107(24):10914-9.

Backbone

• Vector backbone: pYFJ16
• Backbone manufacturer: Gift from John Cronan
• Backbone size w/o insert (bp): 4800
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LplA W37V
• Alt name: coumarin ligase
• Alt name: coumarin PRIME ligase
• Species: E. Coli
• Insert Size (bp): 1014
• Mutation: Mutated Trp37 to Val
• Entrez Gene: lplA (a.k.a. b4386, ECK4378, JW4349, slr, yjjF)
• Promoter: T5 promoter
• Tag / Fusion Protein:
  • His Tag (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: SphI (not destroyed)
• 5′ sequencing primer: GAATTCATTAAAGAGGAG
• 3′ sequencing primer: CTTTCTCTTCGATTTGCCGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Received original LplA plasmid from John Cronan (currently at UI-UC)
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry