Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

NpuDnaEc-cGCaMP2
(Plasmid #34851)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 34851 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTriEx-3
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5000
  • Vector type
    Mammalian Expression, Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NpuDnaEc-cGCaMP2
  • Species
    Nostoc punctiforme
  • Insert Size (bp)
    1014
  • Promoter CMV, T7 lac

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer (TriEx UP) GTTATTGTGCTGTCTCATCA
  • 3′ sequencing primer T7 terminal
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    NpuDnaEc-cGCaMP2 was a gift from Kevin Truong (Addgene plasmid # 34851 ; http://n2t.net/addgene:34851 ; RRID:Addgene_34851)
  • For your References section:

    Split-intein mediated re-assembly of genetically encoded Ca(2+) indicators. Wong SS, Kotera I, Mills E, Suzuki H, Truong K. Cell Calcium. 2011 Nov 29. 10.1016/j.ceca.2011.10.006 PubMed 22133610