1
Plasmid 35009: p6610 MSCV-IP N-HAonly TIMP1
  • TIMP1

  • H. sapiens (human)

  • TIMP1 (RP1-230G1.3, CLGI, EPA, EPO, HCI, TIMP)

  • HA

  • N terminal on backbone

  • MSCV-IP N-HAonly
    (Search Vector Database)

  • Mammalian Expression, Retroviral

  • 8100

  • NTap mod. by E.White to remove Flag

  • MSCV LTR

  • Gateway Cloning

  • 5' CTACATCGTGACCTGGGAAGC 3' List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • Unknown

  • Puromycin

  • View sequences (1)
  • Peter Howley

  • UBMTA

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Systematic identification of interactions between host cell proteins and E7 oncoproteins from diverse human papillomaviruses. White et al (Proc Natl Acad Sci U S A. 2012 Jan 9. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35009" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only