p6652 MSCV-P C-Flag HA 8E7-Kozak
(Plasmid #35145)

Loading...
Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    MSCV-P C-Flag-HA
  • Backbone size w/o insert (bp) 8700
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.

Gene/Insert

  • Gene/Insert name
    HPV8 E7
  • Species
    Human papillomavirus type 8
  • Insert Size (bp)
    300
  • Tags / Fusion Proteins
    • FLAG (C terminal on backbone)
    • HA (C terminal on backbone)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer 5' CTACATCGTGACCTGGGAAGC 3'
  • 3′ sequencing primer MSCV-rev
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    p6652 MSCV-P C-Flag HA 8E7-Kozak was a gift from Peter Howley (Addgene plasmid # 35145)
  • For your References section:

    Systematic identification of interactions between host cell proteins and E7 oncoproteins from diverse human papillomaviruses. White EA, Sowa ME, Tan MJ, Jeudy S, Hayes SD, Santha S, Munger K, Harper JW, Howley PM. Proc Natl Acad Sci U S A. 2012 Jan 9. 10.1073/pnas.1116776109 PubMed 22232672