pBbE1k-RFP
(Plasmid
#35333)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 35333 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBb
- Backbone size w/o insert (bp) 3528
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRFP
-
Alt nameJBEI Part ID: JPUB_000099
-
SpeciesSynthetic
-
Insert Size (bp)678
- Promoter Trc
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer jkRFP-R (gctttggaaccgtactggaa)
- 3′ sequencing primer jkRFP-F (tggtcactacgacgctgaag) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
JBEI Part ID: JPUB_000099; Origin: colE1
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBbE1k-RFP was a gift from Jay Keasling (Addgene plasmid # 35333 ; http://n2t.net/addgene:35333 ; RRID:Addgene_35333) -
For your References section:
BglBrick vectors and datasheets: A synthetic biology platform for gene expression. Lee TS, Krupa RA, Zhang F, Hajimorad M, Holtz WJ, Prasad N, Lee SK, Keasling JD. J Biol Eng. 2011 Sep 20;5:12. 10.1186/1754-1611-5-12 PubMed 21933410