Plasmid 35369: pBbS0k-RFP
  • RFP

  • JBEI Part ID: JPUB_000262

  • 678

  • Synthetic

  • pBb
    (Search Vector Database)

  • Bacterial Expression

  • 3701

  • jkRFP-R (gctttggaaccgtactggaa) List of Sequencing Primers

  • jkRFP-F (tggtcactacgacgctgaag)

  • Kanamycin

  • DH5alpha

  • 37

  • Low Copy

  • View sequences (3)
  • Jay Keasling



JBEI Part ID: JPUB_000262; Origin: SC101

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: BglBrick vectors and datasheets: A synthetic biology platform for gene expression. Lee et al (J Biol Eng. 2011 Sep 20;5:12. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35369" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only
This is commonly requested with
35367: pBbS0a-RFP
35375: pBbA0a-RFP