1
Plasmid 35488: pAAV-FLEX-hHTB-WPRE
  • htTA

  • humanized tet transactivator

  • mammalian codon optimized

  • H2B

  • histon H2B

  • EGFP

  • C terminal on insert

  • mammalian codon optimized

  • TVA, B19G

  • rabies B19 Glycoprotein

  • mammalian codon optimized

  • Custom Synthesized
    (Search Vector Database)

  • Mr. Gene

  • Cre/Lox ; AAV

  • SpeI

  • No

  • Unknown

  • Unknown

  • LNCX List of Sequencing Primers

  • Unknown

  • Unknown

  • SalI

  • No

  • NA List of Sequencing Primers

  • hGHpA-R (CAGAAGGACAGGGAAGGGAG)

  • Ampicillin

  • Stbl3

  • 37

  • Unknown

  • View sequences (3)
  • Edward Callaway

  • MTA
    Tet Systems Limited Use Label License

Comments: 

Improved version of plasmid 26196.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35488" in your Materials and Methods section.

Pending

This plasmid is currently not available for distribution from Addgene. Please check back later. If you have further questions, please contact Addgene at help@addgene.org.