Holiday Schedule: Addgene will be closed December 22nd & 25th and January 1st. For details, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #35488)


Item Catalog # Description Quantity Price (USD)
Plasmid 35488 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number

Gene/Insert 1

  • Gene/Insert name
  • Alt name
    humanized tet transactivator
  • Mutation
    mammalian codon optimized

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer LNCX
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Alt name
    histon H2B
  • Mutation
    mammalian codon optimized
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Gene/Insert 3

  • Gene/Insert name
    TVA, B19G
  • Alt name
    rabies B19 Glycoprotein
  • Mutation
    mammalian codon optimized

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer NA
  • 3′ sequencing primer hGHpA-R (CAGAAGGACAGGGAAGGGAG)
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Improved version of plasmid 26196.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-FLEX-hHTB-WPRE was a gift from Edward Callaway (Addgene plasmid # 35488)