Skip to main content
Addgene
Open Menu

pAAV-FLEX-hHTB-WPRE
(Plasmid #35488)

Print

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 35488 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    Custom Synthesized
  • Backbone manufacturer
    Mr. Gene
  • Vector type
    AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    htTA
  • Alt name
    humanized tet transactivator
  • Mutation
    mammalian codon optimized

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer LNCX
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    H2B
  • Alt name
    histon H2B
  • Mutation
    mammalian codon optimized
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Gene/Insert 3

  • Gene/Insert name
    TVA, B19G
  • Alt name
    rabies B19 Glycoprotein
  • Mutation
    mammalian codon optimized

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer NA
  • 3′ sequencing primer hGHpA-R (CAGAAGGACAGGGAAGGGAG)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Improved version of plasmid 26196.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-FLEX-hHTB-WPRE was a gift from Edward Callaway (Addgene plasmid # 35488)
Related items: