pAAV-FLEX-hHTB-WPRE
(Plasmid #35488)

• Depositing Lab: Edward Callaway
• Publication: Callaway lab plasmids (unpublished)

Backbone

• Vector backbone: Custom Synthesized
• Backbone manufacturer: Mr. Gene
• Vector type: AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: htTA
• Alt name: humanized tet transactivator
• Mutation: mammalian codon optimized

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: SpeI (not destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: LNCX

Gene/Insert 2

• Gene/Insert name: H2B
• Alt name: histon H2B
• Mutation: mammalian codon optimized
• Tag / Fusion Protein:
  • EGFP (C terminal on insert)

Gene/Insert 3

• Gene/Insert name: TVA, B19G
• Alt name: rabies B19 Glycoprotein
• Mutation: mammalian codon optimized

Cloning Information for Gene/Insert 3

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: NA
• 3′ sequencing primer: hGHpA-R (CAGAAGGACAGGGAAGGGAG)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Improved version of plasmid 26196.