Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

pUG2K
(Plasmid #35493)

Add to Cart
Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pUltra
  • Backbone manufacturer
    Malcom Moore
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    KRAS(G12V)
  • Species
    H. sapiens (human)
  • Mutation
    G12V
  • Promoter Ubiquitin C

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xba1 (not destroyed)
  • 3′ cloning site BamH1 (not destroyed)
  • 5′ sequencing primer ccactacctgagcacccagt
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    We inserted PCR amplified constitutively active KRAS(G12V) from the pBabe K-Ras 12V plasmid (Channing Der) into pUltra.
  • Terms and Licenses
How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUG2K was a gift from Ramesh Shivdasani (Addgene plasmid # 35493)
  • For your References section:

    Differential WNT activity in colorectal cancer confers limited tumorigenic potential and is regulated by MAPK signaling. Horst D, Chen J, Morikawa T, Ogino S, Kirchner T, Shivdasani RA. Cancer Res. 2012 Feb 8. 10.1158/0008-5472.CAN-11-3222 PubMed 22318865