1
Plasmid 35493: pUG2K
  • KRAS(G12V)

  • H. sapiens (human)

  • G12V

  • pUltra
    (Search Vector Database)

  • Malcom Moore

  • Mammalian Expression, Lentiviral

  • Ubiquitin C

  • Xba1

  • No

  • BamH1

  • No

  • ccactacctgagcacccagt List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 37

  • High Copy

  • We inserted PCR amplified constitutively active KRAS(G12V) from the pBabe K-Ras 12V plasmid (Channing Der) into pUltra.

  • View sequences (2)
  • Ramesh Shivdasani

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Differential WNT activity in colorectal cancer confers limited tumorigenic potential and is regulated by MAPK signaling. Horst et al (Cancer Res. 2012 Feb 8. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35493" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only