Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed November 28th & 29th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of November 25th - 29th. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGL3-321/+120 mut1&2
(Plasmid #35546)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 35546 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGL3-basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4818
  • Total vector size (bp) 5250
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    promoter region of miR200b-200a-429 genomic cluster
  • Alt name
    MIRN200B
  • Alt name
    MIRN200A
  • Alt name
    MIRN429
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    441
  • Mutation
    T to G at position -52 and T to G at position -96 in promoter
  • GenBank ID
    406984 406983
  • Entrez Gene
    MIR200B (a.k.a. MIRN200B, mir-200b)
  • Entrez Gene
    MIR429 (a.k.a. MIRN429, hsa-mir-429, mir-429)
  • Entrez Gene
    MIR200A (a.k.a. MIRN200A, mir-200a)
  • Promoter none
  • Tag / Fusion Protein
    • luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
  • 3′ sequencing primer CTTTATGTTTTTGGCGTCTTCCA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-321/+120 mut1&2 was a gift from Greg Goodall (Addgene plasmid # 35546 ; http://n2t.net/addgene:35546 ; RRID:Addgene_35546)
  • For your References section:

    A double-negative feedback loop between ZEB1-SIP1 and the microRNA-200 family regulates epithelial-mesenchymal transition. Bracken CP, Gregory PA, Kolesnikoff N, Bert AG, Wang J, Shannon MF, Goodall GJ. Cancer Res. 2008 Oct 1;68(19):7846-54. 10.1158/0008-5472.CAN-08-1942 PubMed 18829540