1
Plasmid 35643: pAAVf-EnhCB-lacZnls mir-122 1xBS
  • 1 miR-122 target site

  • 23

  • Synthetic

  • pAAVf-EnhCB-lacZnls
    (Search Vector Database)

  • AAV

  • CB

  • BstB I

  • No

  • BstB I

  • No

  • TGAAGCTGAAGCCTGTGATG List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (3)
  • VNTI map of pAAVf-EnhCB-lacZnls 1xmiR122BS (chemical/seq-na-genbank)

  • Phillip Zamore

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35643" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only
This is commonly requested with