1
Plasmid 35651: pAAVscCBPITuDlet-7Gpluc7xlet7BT
  • TuD let-7

  • 463

  • Synthetic

  • pAAVscCBPIGpluc7xlet-7BT
    (Search Vector Database)

  • AAV

  • 4895

  • U6

  • PpuMI

  • Yes

  • PpuMI

  • Yes

  • gagggcctatttcccatgat List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (3)
  • map of pAAVscCBPITuDlet-7Gpluc7xlet7BT (chemical/seq-na-genbank)

  • Phillip Zamore

  • UBMTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35651" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only
This is commonly requested with