Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

pAAVscCBPITuDlet-7Gpluc7xlet7BT
(Plasmid #35651)

Add to Cart
Available to Academic and Nonprofits Only

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    TuD let-7
  • Species
    Synthetic
  • Insert Size (bp)
    463
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PpuMI (destroyed during cloning)
  • 3′ cloning site PpuMI (destroyed during cloning)
  • 5′ sequencing primer gagggcctatttcccatgat
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAVscCBPITuDlet-7Gpluc7xlet7BT was a gift from Phillip Zamore (Addgene plasmid # 35651)