pAAVscCBPITuDlet-7Gpluc7xlet7BT
(Plasmid #35651)

Available to Academic and Nonprofits Only

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    TuD let-7
  • Species
    Synthetic
  • Insert Size (bp)
    463
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PpuMI (destroyed during cloning)
  • 3′ cloning site PpuMI (destroyed during cloning)
  • 5′ sequencing primer gagggcctatttcccatgat
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAVscCBPITuDlet-7Gpluc7xlet7BT was a gift from Phillip Zamore (Addgene plasmid # 35651)