Plasmid 35671: pRNA-U6-ZipmiR122
  • miR-122Zip

  • 397

  • Synthetic

  • pRNA-U6.1/Neo-siFluc
    (Search Vector Database)

  • Genscript

  • 5124

  • U6

  • EcoR I

  • No

  • Hind III

  • No

  • gagggcctatttcccatgat List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (3)
  • VNTI map of pRNA-U6-ZipmiR122 (chemical/seq-na-genbank)

  • Phillip Zamore

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35671" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only
This is commonly requested with