Plasmid 35671: pRNA-U6-ZipmiR122
  • miR-122Zip

  • 397

  • Synthetic

  • pRNA-U6.1/Neo-siFluc
    (Search Vector Database)

  • Genscript

  • 5124

  • U6

  • EcoR I

  • No

  • Hind III

  • No

  • gagggcctatttcccatgat List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (3)
  • VNTI map of pRNA-U6-ZipmiR122 (chemical/seq-na-genbank)

  • Phillip Zamore


Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 35671" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only
This is commonly requested with