pRNA-U6-ZipmiR122
(Plasmid #35671)

Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pRNA-U6.1/Neo-siFluc
  • Backbone manufacturer
    Genscript
  • Backbone size w/o insert (bp) 5124

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Sequence Information

Gene/Insert

  • Gene/Insert name
    miR-122Zip
  • Species
    Synthetic
  • Insert Size (bp)
    397
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR I (not destroyed)
  • 3′ cloning site Hind III (not destroyed)
  • 5′ sequencing primer gagggcctatttcccatgat
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRNA-U6-ZipmiR122 was a gift from Phillip Zamore (Addgene plasmid # 35671)