-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 36394 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSMP
-
Backbone manufacturerSteve Elledge
- Backbone size w/o insert (bp) 6699
-
Vector typeMammalian Expression, Retroviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFirefly Luciferase
-
gRNA/shRNA sequenceCCCGCCTGAAGTCTCTGATTAA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer pSMP-F (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSMP-Luc was a gift from George Daley (Addgene plasmid # 36394 ; http://n2t.net/addgene:36394 ; RRID:Addgene_36394) -
For your References section:
Chromatin-modifying enzymes as modulators of reprogramming. Onder TT, Kara N, Cherry A, Sinha AU, Zhu N, Bernt KM, Cahan P, Marcarci BO, Unternaehrer J, Gupta PB, Lander ES, Armstrong SA, Daley GQ. Nature. 2012 Mar 4;483(7391):598-602. doi: 10.1038/nature10953. 10.1038/nature10953 PubMed 22388813
Map uploaded by the depositor.