1
Plasmid 36394: pSMP-Luc
  • Firefly Luciferase

  • CCCGCCTGAAGTCTCTGATTAA

  • pSMP
    (Search Vector Database)

  • Steve Elledge

  • Mammalian Expression, Retroviral, RNAi

  • 6699

  • XhoI

  • No

  • EcoRI

  • No

  • pSMP-F List of Sequencing Primers

  • Ampicillin

  • Stbl3

  • 30

  • High Copy

  • Puromycin

  • View sequences (1)
  • View map

  • George Daley

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Chromatin-modifying enzymes as modulators of reprogramming. Onder et al (Nature. 2012 Mar 4;483(7391):598-602. doi: 10.1038/nature10953. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 36394" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only