Skip to main content
Holiday Schedule: Addgene will be closed November 26th & 27th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about your shipment please contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pBAD LIC cloning vector (8A)
(Plasmid #37501)


Item Catalog # Description Quantity Price (USD)
Plasmid 37501 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size (bp) 5629
  • Vector type
    Bacterial Expression
  • Promoter araBAD arabinose

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ARA F (5'cattctgtaacaaagcggga)
  • 3′ sequencing primer ARA Rv (5'ctgttttatcagaccgcttc)
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

This plasmid is an empty vector. Your gene can be inserted via LIC cloning.

8-series vectors are induced with L-arabinose for tighter control of expression. Glucose can be added to the medium to further inhibit leaky expression. The plasmid can be expressed in any E. coli line that lacks proteases.

8A has no fusion tags, appropriate for expressing untagged protein. If your protein doesn't express well in this vector, note that expression can usually be enhanced by adding a short N-terminal fusion sequence. If this is the case for your protein, try one of our other arabinose-inducible LIC vectors (e.g. 8B).

To clone into this vector, add LIC v2 tags to the 5' end of your PCR primers.



Linearize the plasmid with EcoRV and gel purify.

When digesting the DNA with T4 polymerase, use dGTP for insert and dCTP for vector.

Visit for more information on this vector

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBAD LIC cloning vector (8A) was a gift from Scott Gradia (Addgene plasmid # 37501 ; ; RRID:Addgene_37501)