Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHL662
(Plasmid #37636)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 37636 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pZ with p15a origin
  • Backbone manufacturer
    Lim Lab
  • Modifications to backbone
    Plasmid modified from Rolf Lutz and Hermann Bujard, 1997
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    mCherry
  • Insert Size (bp)
    711
  • Promoter pLtetO-1

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site ApaI (not destroyed)
  • 5′ sequencing primer CAGTCATAGCCGAATAGCCT
  • 3′ sequencing primer GTA TGT TGC ATC ACC TTC ACC CTC TCC ACT GAC AG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    GFP
  • Insert Size (bp)
    717
  • Promoter pLlacO-1

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XmaI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GACGGGCCC ATGGTACGCGTGCTAGAGG
  • 3′ sequencing primer ccggaattc ACTGCTCACA AGAAAAAAGG CACG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    mCherry gene from Tsien Lab
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHL662 was a gift from Han Lim (Addgene plasmid # 37636 ; http://n2t.net/addgene:37636 ; RRID:Addgene_37636)
  • For your References section:

    Rapid and robust signaling in the CsrA cascade via RNA-protein interactions and feedback regulation. Adamson DN, Lim HN. Proc Natl Acad Sci U S A. 2013 Aug 6;110(32):13120-5. doi: 10.1073/pnas.1308476110. Epub 2013 Jul 22. 10.1073/pnas.1308476110 PubMed 23878244