Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pGFH-14c
(Plasmid #39541)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 39541 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-C1P
  • Total vector size (bp) 5123
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SRP14
  • Species
    H. sapiens (human)
  • GenBank ID
    X73459.1
  • Entrez Gene
    SRP14 (a.k.a. ALURBP)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Eco R1 (not destroyed)
  • 3′ cloning site Xma I (not destroyed)
  • 5′ sequencing primer GAAGCGCGATCACATGGTCC
  • 3′ sequencing primer GTTCAGGGGGAGGTGTGGGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that Addgene's sequencing results identified nucleotide mismatches at bp# 1540, 1645, 1750 and 1774-80 when compared to the full plasmid sequence provided by the depositing laboratory. These differences are not known to affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGFH-14c was a gift from Katharina Strub (Addgene plasmid # 39541 ; http://n2t.net/addgene:39541 ; RRID:Addgene_39541)
  • For your References section:

    SRP keeps polypeptides translocation-competent by slowing translation to match limiting ER-targeting sites. Lakkaraju AK, Mary C, Scherrer A, Johnson AE, Strub K. Cell. 2008 May 2;133(3):440-51. 10.1016/j.cell.2008.02.049 PubMed 18455985