Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pEG545
(Plasmid #40116)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 40116 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDONR201
  • Backbone manufacturer
    Invitrogen
  • Backbone size (bp) 4470
  • Modifications to backbone
    The following have been added to the Gateway donor vector by Gateway cloning: Dendra2 PAFP, TEV protease cleavage site, S-epitope,
  • Vector type
    Gateway Donor vector
  • Tags / Fusion Proteins
    • Dendra2 PAFP (sequence optimized for worm expression; three synthetic introns inserted) (N terminal on backbone)
    • TEV protease cleavage site (N terminal on backbone)
    • S-peptide (N terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer T1ter-rev (AAACGAAAGGCCCAGTCTTC)
  • 3′ sequencing primer Kan-R (ATCGCGAGCCCATTTATACC)
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid

Depositor Comments

This vector can be used to make Dendra2 PAFP N-terminal fusions by multi-site Gateway reaction.

Alternate plasmid name: pDONR 201 + Dendra2 (TEV/Spep)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEG545 was a gift from Geraldine Seydoux (Addgene plasmid # 40116 ; http://n2t.net/addgene:40116 ; RRID:Addgene_40116)
  • For your References section:

    Regulation of the MEX-5 gradient by a spatially segregated kinase/phosphatase cycle. Griffin EE, Odde DJ, Seydoux G. Cell. 2011 Sep 16;146(6):955-68. 10.1016/j.cell.2011.08.012 PubMed 21925318