pFA6-luc*(-SKL)-HIS3MX6
(Plasmid #40233)

• Depositing Lab: Michael Benton
• Publication: pFA6-yEGFP1-HIS3MX6 (unpublished)

Backbone

• Vector backbone: pFA6a-His3MX6
• Backbone size w/o insert (bp): 4055
• Total vector size (bp): 5705
• Vector type: Bacterial Expression
• Selectable markers: HIS3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: luc*(-SKL)
• Alt name: Firefly luciferase
• Alt name: Photinus pyralis luciferase
• Alt name: luciferase, Fluc
• Species: Photinus pyralis
• Insert Size (bp): 1650

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SmaI (not destroyed)
• 3′ cloning site: AscI (not destroyed)
• 5′ sequencing primer: CGCCAGCTGAAGCTTCGTA
• 3′ sequencing primer: aatctgacgcaggcagttct

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Leskinen P, Virta M and Karp M (2003). One-step measurement of firefly luciferase activity in yeast. Yeast 20(13): 1109-1113. Bonin AL, Gossen M and Bujard H (1994). Photinus pyralis luciferase: vectors that contain a modified luc coding sequence allowing convenient transfer into other systems. Gene 141(1): 75-77.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry