Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

psiCheck2 6xmut UTR
(Plasmid #40764)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 40764 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 6273
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    6 copies (3 site expanded) of the CXCR4 small RNA target site
  • Promoter TK/SV40
  • Tag / Fusion Protein
    • luciferase (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 3′ sequencing primer TCAGACAAACCCTAACCACCGC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

This plasmid also contains a firefly reporter cassette that has been specifically designed to be an intraplasmid transfection normalization reporter.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psiCheck2 6xmut UTR was a gift from Phillip Zamore (Addgene plasmid # 40764 ; ; RRID:Addgene_40764)
  • For your References section:

    Argonaute protein identity and pairing geometry determine cooperativity in mammalian RNA silencing. Broderick JA, Salomon WE, Ryder SP, Aronin N, Zamore PD. RNA. 2011 Oct;17(10):1858-69. Epub 2011 Aug 30. 10.1261/rna.2778911 PubMed 21878547