psiCheck2 6xmut UTR
(Plasmid
#40764)
-
PurposeRenilla luciferase reporter containing siRNA target sites
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40764 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepsiCheck2
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 6273
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name6 copies (3 site expanded) of the CXCR4 small RNA target site
- Promoter TK/SV40
-
Tag
/ Fusion Protein
- luciferase (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CCAATGCTATTGTTGAAGGTGCCAAG
- 3′ sequencing primer TCAGACAAACCCTAACCACCGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid also contains a firefly reporter cassette that has been specifically designed to be an intraplasmid transfection normalization reporter.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
psiCheck2 6xmut UTR was a gift from Phillip Zamore (Addgene plasmid # 40764 ; http://n2t.net/addgene:40764 ; RRID:Addgene_40764) -
For your References section:
Argonaute protein identity and pairing geometry determine cooperativity in mammalian RNA silencing. Broderick JA, Salomon WE, Ryder SP, Aronin N, Zamore PD. RNA. 2011 Oct;17(10):1858-69. Epub 2011 Aug 30. 10.1261/rna.2778911 PubMed 21878547