Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

psiCheck-2-3 x mir-34
(Plasmid #40831)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 40831 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 6273
  • Vector type
    Insect Expression, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    three sites partially complementary to miR-34
  • Species
    D. melanogaster (fly)
  • Entrez Gene
    mir-34 (a.k.a. Dmel_CR43033, 34, CR33326, CR43033, Dmel\CR43033, Dmel_CR33326, Mir-34, dme-miR-34, dme-mir-34, miR-34)
  • Promoter SV40
  • Tag / Fusion Protein
    • luciferase (N terminal on backbone)

Cloning Information

Resource Information

  • Terms and Licenses

Depositor Comments

The psiCheck-3xmiR-34 sequences were cloned by synthesized dsDNA



the triple(3x)-repeated sequence:



pairs with dme-miR-34 (uggcagugugguuagcugguugug) with "seed(red) plus 3' complementary region (blue)" fashion.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psiCheck-2-3 x mir-34 was a gift from Phillip Zamore (Addgene plasmid # 40831 ; ; RRID:Addgene_40831)
  • For your References section:

    The 3'-to-5' exoribonuclease Nibbler shapes the 3' ends of microRNAs bound to Drosophila Argonaute1. Han BW, Hung JH, Weng Z, Zamore PD, Ameres SL. Curr Biol. 2011 Nov 22;21(22):1878-87. Epub 2011 Nov 3. 10.1016/j.cub.2011.09.034 PubMed 22055293