psiCheck-2-3 x mir-34
(Plasmid
#40831)
-
PurposeLuciferase reporter
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 40831 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepsiCheck-2
-
Backbone manufacturerpromega
- Backbone size w/o insert (bp) 6273
-
Vector typeInsect Expression, RNAi
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namethree sites partially complementary to miR-34
-
SpeciesD. melanogaster (fly)
-
Entrez Genemir-34 (a.k.a. Dmel_CR43033, 34, CR33326, CR43033, Dmel\CR43033, Dmel_CR33326, Mir-34, dme-miR-34, dme-mir-34, miR-34)
- Promoter SV40
-
Tag
/ Fusion Protein
- luciferase (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer RLucF (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Depositor Comments
The psiCheck-3xmiR-34 sequences were cloned by synthesized dsDNA
S: 5'-TCGAGGTGTTGATGCTAAGGTCACTGCCAGTGTTGATGCTAAGGTCACTGCCAGTGTTGATGCTAAGGTCACTGCCAGC
AS: 5'-GGCCGCTGGCAGTGACCTTAGCATCAACACTGGCAGTGACCTTAGCATCAACACTGGCAGTGACCTTAGCATCAACACC
the triple(3x)-repeated sequence:
5'TGGCAGTGACCTTAGCATCAACAC-3'
3'ACCGTCACTGGAATCGTAGTTGTG-5'
pairs with dme-miR-34 (uggcagugugguuagcugguugug) with "seed(red) plus 3' complementary region (blue)" fashion.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
psiCheck-2-3 x mir-34 was a gift from Phillip Zamore (Addgene plasmid # 40831 ; http://n2t.net/addgene:40831 ; RRID:Addgene_40831) -
For your References section:
The 3'-to-5' exoribonuclease Nibbler shapes the 3' ends of microRNAs bound to Drosophila Argonaute1. Han BW, Hung JH, Weng Z, Zamore PD, Ameres SL. Curr Biol. 2011 Nov 22;21(22):1878-87. Epub 2011 Nov 3. 10.1016/j.cub.2011.09.034 PubMed 22055293