Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #40882)

Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 40882 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Turner and Weintraub (1994)
  • Backbone size (bp) 4095
  • Modifications to backbone
    Four 8bp cutter restriction enzymes (AscI, PacI, FseI, AsiSI) were introduced.
  • Vector type
    Sea urchin, zebrafish, Xenopus
  • Promoter SP6
  • Tag / Fusion Protein
    • mOrange (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CTTGATTTAGGTGACACTATAG
  • 3′ sequencing primer TGTTGTTAACTTGTTTATTGCA
  • (Common Sequencing Primers)

Terms and Licenses

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS2+8CmOrange was a gift from Amro Hamdoun (Addgene plasmid # 40882 ; ; RRID:Addgene_40882)
  • For your References section:

    Localization and Substrate Selectivity of Sea Urchin Multidrug (MDR) Efflux Transporters. Gokirmak T, Campanale JP, Shipp LE, Moy GW, Tao H, Hamdoun A. J Biol Chem. 2012 Nov 2. 10.1074/jbc.M112.424879 PubMed 23124201