siCheck2-taranismutant3'UTR
(Plasmid
#41107)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 41107 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonesiCheck2
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 6700
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Mach1
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nametaranismutant3'UTR
-
SpeciesSynthetic
-
Insert Size (bp)700
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer ATGAAATGGGTAAGTACATCAAGAGCTTCG
- 3′ sequencing primer TCCTCACACAAAAAACCAACACACAGATGT (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
siCheck2-taranismutant3'UTR was a gift from Phillip Zamore (Addgene plasmid # 41107 ; http://n2t.net/addgene:41107 ; RRID:Addgene_41107) -
For your References section:
Dicer Partner Proteins Tune the Length of Mature miRNAs in Flies and Mammals. Fukunaga R, Han BW, Hung JH, Xu J, Weng Z, Zamore PD. Cell. 2012 Oct 9. pii: S0092-8674(12)01171-3. doi: 10.1016/j.cell.2012.09.027. 10.1016/j.cell.2012.09.027 PubMed 23063653