Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

proE-cad178-Luc-mEbox
(Plasmid #42082)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 42082 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGL3-Basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4807
  • Total vector size (bp) 5077
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    E-cadherin
  • Alt name
    CDH1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    270
  • Mutation
    contains E-cadherin promoter region from -178 to +92. The E-box sequences of CACCTG at −24 and CAGGTG at -74 were mutated to AACCTA and AAGGTA, respectively.
  • GenBank ID
    NM_004360
  • Entrez Gene
    CDH1 (a.k.a. Arc-1, BCDS1, CD324, CDHE, ECAD, LCAM, UVO)
  • Promoter E-cadherin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    proE-cad178-Luc-mEbox was a gift from Kumiko Ui-Tei (Addgene plasmid # 42082 ; http://n2t.net/addgene:42082 ; RRID:Addgene_42082)
  • For your References section:

    E-cadherin is transcriptionally activated via suppression of ZEB1 transcriptional repressor by small RNA-mediated gene silencing. Mazda M, Nishi K, Naito Y, Ui-Tei K. PLoS One. 2011;6(12):e28688. doi: 10.1371/journal.pone.0028688. Epub 2011 Dec 21. 10.1371/journal.pone.0028688 PubMed 22205962