Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLHCX-Flag-mPKM2(C358S)
(Plasmid #42513)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 42513 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLHCX
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 6800
  • Total vector size (bp) 8400
  • Vector type
    Retroviral
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Pyruvate Kinase M2 Cys358->Ser
  • Alt name
    PKM2 C358S mutant
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1600
  • Mutation
    Changed Cysteine 358 to Serine
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer ACCTACAGGTGGGGTCTTTCATTCCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Changed Cys358 codon to Ser358 by 2-step PCR mutagenesis using pLHCX-FT-PKM2 as template

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLHCX-Flag-mPKM2(C358S) was a gift from Dimitrios Anastasiou (Addgene plasmid # 42513 ; http://n2t.net/addgene:42513 ; RRID:Addgene_42513)
  • For your References section:

    Inhibition of pyruvate kinase M2 by reactive oxygen species contributes to cellular antioxidant responses. Anastasiou D, Poulogiannis G, Asara JM, Boxer MB, Jiang JK, Shen M, Bellinger G, Sasaki AT, Locasale JW, Auld DS, Thomas CJ, Vander Heiden MG, Cantley LC. Science. 2011 Dec 2;334(6060):1278-83. doi: 10.1126/science.1211485. Epub 2011 Nov 3. 10.1126/science.1211485 PubMed 22052977