shBIRC5 # 2
(Plasmid
#42554)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 42554 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1
-
Backbone manufacturerTRC
- Backbone size w/o insert (bp) 8000
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshBIRC5
-
gRNA/shRNA sequenceCCTTTCTGTCAAGAAGCAGTT
-
SpeciesH. sapiens (human)
-
GenBank IDNM_001012270
-
Entrez GeneBIRC5 (a.k.a. API4, EPR-1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Age1 (destroyed during cloning)
- 3′ cloning site EcoR1 (destroyed during cloning)
- 5′ sequencing primer pLKOF
- 3′ sequencing primer pLKOR (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe Broad RNAi consortium (TRC)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
TRCN0000073718
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
shBIRC5 # 2 was a gift from William Hahn (Addgene plasmid # 42554 ; http://n2t.net/addgene:42554 ; RRID:Addgene_42554) -
For your References section:
beta-Catenin-Driven Cancers Require a YAP1 Transcriptional Complex for Survival and Tumorigenesis. Rosenbluh J, Nijhawan D, Cox AG, Li X, Neal JT, Schafer EJ, Zack TI, Wang X, Tsherniak A, Schinzel AC, Shao DD, Schumacher SE, Weir BA, Vazquez F, Cowley GS, Root DE, Mesirov JP, Beroukhim R, Kuo CJ, Goessling W, Hahn WC. Cell. 2012 Dec 21;151(7):1457-73. doi: 10.1016/j.cell.2012.11.026. Epub 2012 Dec 13. 10.1016/j.cell.2012.11.026 PubMed 23245941