p6671 MSCV-IP N-HAonly 38E6
(Plasmid
#44144)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44144 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneMSCV-IP N-HAonly
- Backbone size w/o insert (bp) 8100
- Total vector size (bp) 8600
-
Modifications to backboneRetroviral vector for HA-tagged HPV38 E6 expression. No starting ATG in viral ORF, translation begins from tag only. Puro resistance protein expressed from an IRES.
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHPV38E6
-
SpeciesHPV38
-
Insert Size (bp)500
- Promoter MSCV LTR
-
Tag
/ Fusion Protein
- HA (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer 5' CTACATCGTGACCTGGGAAGC 3' (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byFrom DKFZ.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
DKFZ is the co-provider of this plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p6671 MSCV-IP N-HAonly 38E6 was a gift from Peter Howley (Addgene plasmid # 44144 ; http://n2t.net/addgene:44144 ; RRID:Addgene_44144) -
For your References section:
Comprehensive analysis of host cellular interactions with human papillomavirus E6 proteins identifies new E6 binding partners and reflects viral diversity. White EA, Kramer RE, Tan MJ, Hayes SD, Harper JW, Howley PM. J Virol. 2012 Dec;86(24):13174-86. doi: 10.1128/JVI.02172-12. Epub 2012 Sep 26. 10.1128/JVI.02172-12 PubMed 23015706