Modified Shipping Schedule: Addgene will be closed November 23rd & 24th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of Nov 20 - 24. If you have any questions, please contact us at [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

N163 nLV EF-1a-Hp1a(CS)-Frbx2(Frb+FrbWobb)-V5-PGK-Puro
(Plasmid #44195)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 44195 Plasmid sent as bacteria in agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    N103
  • Backbone size w/o insert (bp) 8600
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cbx5
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    357
  • Mutation
    N-term chromo domain removed
  • Promoter EF-1a
  • Tags / Fusion Proteins
    • Frb (C terminal on insert)
    • Hu Frb x2(WT Frb+codon Wobble Frb) (C terminal on insert)
    • V5/epitope (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GGCACTTGATGTAATTCTCCTTG
  • 3′ sequencing primer gtggatgtggaatgtgtgcga
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    N163 nLV EF-1a-Hp1a(CS)-Frbx2(Frb+FrbWobb)-V5-PGK-Puro was a gift from Jerry Crabtree (Addgene plasmid # 44195)
  • For your References section:

    Dynamics and memory of heterochromatin in living cells. Hathaway NA, Bell O, Hodges C, Miller EL, Neel DS, Crabtree GR. Cell. 2012 Jun 22;149(7):1447-60. doi: 10.1016/j.cell.2012.03.052. Epub 2012 Jun 14. 10.1016/j.cell.2012.03.052 PubMed 22704655