Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

K15/pGL3
(Plasmid #44264)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 44264 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGL3-Basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4818
  • Total vector size (bp) 9800
  • Vector type
    Mammalian Expression, Mouse Targeting, Luciferase
  • Selectable markers
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    K15 promoter (-4.8)
  • Alt name
    Krt1-15 promoter
  • Alt name
    mouse keratin 15 promoter
  • Alt name
    Krt15 keratin 15
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    4961
  • Mutation
    Contains the murine K15 promoter (-4.8) fragment
  • GenBank ID
    NC_000077.6 AF542050
  • Entrez Gene
    Krt15 (a.k.a. RP23-217I3.2, AI528832, K15, Krt1-15)
  • Promoter murine K15 promoter (-4.8) fragment
  • Tag / Fusion Protein
    • Luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer RVprimer3
  • 3′ sequencing primer LucNRev; EBV-rev
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Alternate plasmid name: K15(-4.8)-pGL3

The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were

CTGAGCTACCAGCGAGACTCC (K15F1)
and
TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1),

respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pGL3-Basic (Promega).

The entire K15 promoter-luciferase transgene can be released by digestion with XhoI/SalI.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    K15/pGL3 was a gift from George Cotsarelis (Addgene plasmid # 44264 ; http://n2t.net/addgene:44264 ; RRID:Addgene_44264)
  • For your References section:

    Keratin 15 promoter targets putative epithelial stem cells in the hair follicle bulge. Liu Y, Lyle S, Yang Z, Cotsarelis G. J Invest Dermatol. 2003 Nov;121(5):963-8. 10.1046/j.1523-1747.2003.12600.x PubMed 14708593