1
Plasmid 44267: K15-TK/pGL3
  • K15 promoter (-4.8)

  • Krt1-15 promoter

  • mouse keratin 15 promoter

  • Krt15 keratin 15

  • 4961

  • M. musculus (mouse)

  • NC_000077.6 AF542050

  • Krt15 (RP23-217I3.2, AI528832, K15, Krt1-15)

  • HSV-1 TK

  • C terminal on insert

  • Contains the murine K15 promoter (-4.8) fragment

  • pGL3-Basic
    (Search Vector Database)

  • Promega

  • Mammalian Expression, Mouse Targeting ; Thymidine kinase

  • 4818

  • Luciferase replaced with HSV-1 TK from a TK/PBSIIKS plasmid by NotI/SalI digestion

  • murine K15 promoter (-4.8) fragment

  • XhoI

  • No

  • SalI

  • No

  • RVprimer3 List of Sequencing Primers

  • pBR322ori-F

  • Ampicillin

  • DH5alpha

  • 37

  • Unknown

  • Thymidine Kinase (HSV-1 TK)

  • View sequences (2)
  • View map

  • George Cotsarelis

  • UBMTA

Comments: 

Alternate plasmid name: K15-HSV-TK-pGL3

The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were

CTGAGCTACCAGCGAGACTCC (K15F1)
and
TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1),

respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pGL3-Basic (Promega) to create plasmid K15(-4.8)-pGL3 (Addgene plasmid #44264).

The HSV-1 TK reporter gene cDNA was then excised from a TK/PBSIIKS plasmid, using NotI and SalI, and cloned downstream of the K15 promoter, replacing luciferase.

The entire K15 promoter-HSV-TK transgene can be released by digestion with XhoI/SalI.

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Stem cells in the hair follicle bulge contribute to wound repair but not to homeostasis of the epidermis. Ito et al (Nat Med. 2005 Dec;11(12):1351-4. Epub 2005 Nov 20. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 44267" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only
This is commonly requested with