Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at help@addgene.org. Learn more

K15-TK/pGL3
(Plasmid #44267)

Add to Cart
Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pGL3-Basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4818
  • Modifications to backbone
    Luciferase replaced with HSV-1 TK from a TK/PBSIIKS plasmid by NotI/SalI digestion
  • Vector type
    Mammalian Expression, Mouse Targeting ; Thymidine kinase
  • Selectable markers
    Thymidine Kinase (HSV-1 TK)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.

Gene/Insert

  • Gene/Insert name
    K15 promoter (-4.8)
  • Alt name
    Krt1-15 promoter
  • Alt name
    mouse keratin 15 promoter
  • Alt name
    Krt15 keratin 15
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    4961
  • Mutation
    Contains the murine K15 promoter (-4.8) fragment
  • GenBank ID
    NC_000077.6 AF542050
  • Entrez Gene
    Krt15 (a.k.a. RP23-217I3.2, AI528832, K15, Krt1-15)
  • Promoter murine K15 promoter (-4.8) fragment
  • Tag / Fusion Protein
    • HSV-1 TK (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer RVprimer3
  • 3′ sequencing primer pBR322ori-F
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Alternate plasmid name: K15-HSV-TK-pGL3

The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were

CTGAGCTACCAGCGAGACTCC (K15F1)
and
TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1),

respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pGL3-Basic (Promega) to create plasmid K15(-4.8)-pGL3 (Addgene plasmid #44264).

The HSV-1 TK reporter gene cDNA was then excised from a TK/PBSIIKS plasmid, using NotI and SalI, and cloned downstream of the K15 promoter, replacing luciferase.

The entire K15 promoter-HSV-TK transgene can be released by digestion with XhoI/SalI.

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    K15-TK/pGL3 was a gift from George Cotsarelis (Addgene plasmid # 44267)
  • For your References section:

    Stem cells in the hair follicle bulge contribute to wound repair but not to homeostasis of the epidermis. Ito M, Liu Y, Yang Z, Nguyen J, Liang F, Morris RJ, Cotsarelis G. Nat Med. 2005 Dec;11(12):1351-4. Epub 2005 Nov 20. 10.1038/nm1328 PubMed 16288281