pINDUCER11 (miR-RUG)
(Plasmid #44363)

• Purpose: Inducible lentiviral gene silencing vector. Insert PheSGly294, (XhoI to EcoR1; 1.4kb), can be replaced w mir30 based hairpin of interest
• Depositing Lab: Thomas Westbrook
• Publication: Meerbrey et al Proc Natl Acad Sci U S A. 2011 Mar 1;108(9):3665-70. doi: 10.1073/pnas.1019736108. Epub 2011 Feb 9.

Backbone

• Vector backbone: GIPZ
• Backbone manufacturer: Open Biosystems
• Backbone size w/o insert (bp): 11688
• Total vector size (bp): 14699
• Modifications to backbone: pINDUCER11 (miR-RUG) was made by first digesting pINDUCER10 with XbaI and PacI to remove the rtTA through the puromycin resistance gene. The rtTAIRES segment was removed from pIndmir3Luc-miR by XbaI and NotI digest. eGFP was PCR amplified from MSCV-N-eGFP-ENTR using primers 5′-TAATACATGT ATCGATCCACCATGGTGAGCAAGGGC and 5′-GATCTTAATTAA TTACTTGTACAGCTCGTCCATGCCG. The PCR product was digested with PciI and PacI. The vector, rtTA-IRES, and eGFP were then ligated and sequence verified.
• Vector type: Lentiviral
• Selectable markers: EGFP; RFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PheS Gly294
• gRNA/shRNA sequence: mir30
• Species: P. haloplanktis

Resource Information

• Supplemental Documents:
  • Viral Production Protocol
• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry