Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #44725)


Item Catalog # Description Quantity Price (USD)
Plasmid 44725 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 6662
  • Total vector size (bp) 6823
  • Modifications to backbone
    CMV promoter replaced with pCMV-D2i promoter. Rabbit β-globin intron and TetR replaced with new Rabbit β-globin intron-mCherry-WPRE fragment.
  • Vector type
    Mammalian Expression, Synthetic Biology ; Expression regulator/reporter
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    XL10 Gold
  • Copy number

Gene/Insert 1

  • Gene/Insert name
    pCMV-D2i promoter
  • Alt name
    Modified CMV-based synthetic promoter containing two tetO2 sites
  • Species
  • Insert Size (bp)
  • Mutation
    Initiator motif (Inr) displaced relative to pCMV-2xtetO (returned to its natural position). Two tetO2 sites flanking Inr motif.
  • Promoter pCMV-D2i

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site AflII (not destroyed)
  • 5′ sequencing primer Amp-R
  • 3′ sequencing primer Bglob-intron-R (TTTGCCCCCTCCATATAACA)
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Alt name
    monomeric dsRed derivative
  • Species
    H. sapiens (human), Synthetic
  • Insert Size (bp)
  • Mutation
    Region around the ATG translation start codon converted to the consensus Kozak sequence; sequence optimized for mammalian codon bias
  • Tags / Fusion Proteins
    • Rabbit β-globin intron II (N terminal on insert)
    • WPRE (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer Bglob-intron-F (ctggtcatcatcctgccttt); CMV-F
  • 3′ sequencing primer WPRE-R; BGH-rev
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Fragment containing the mCherry gene from the pTRE-Dual2 plasmid (Clontech). Fragment containing WPRE from plasmid pLVX-DD-tdTomato (Clontech). Modified CMV-based synthetic promoter pCMV-D2i synthesized de novo (Bio Basic Inc., Markham, Ontario, Canada).
  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDN-D2irC6kwh was a gift from Gabor Balazsi (Addgene plasmid # 44725 ; ; RRID:Addgene_44725)
  • For your References section:

    Transferring a synthetic gene circuit from yeast to mammalian cells. Nevozhay D, Zal T, Balazsi G. Nat Commun. 2013 Feb 5;4:1451. doi: 10.1038/ncomms2471. 10.1038/ncomms2471 PubMed 23385595