1
Plasmid 45066: pRSV-PKI-v2
  • Expression of PKI (PKA inhibitor)

  • cAMP-dependent protein kinase inhibitor alpha

  • PKI alpha

  • 250

  • Synthetic

  • M23079.1

  • pRSV-link
    (Search Vector Database)

  • Maurer lab

  • Mammalian Expression

  • 4265

  • Backbone derived from pRSV-globin

  • RSV

  • HindIII

  • No

  • NotI

  • No

  • CGATACAATAAACGCCATTTGA List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (2)
  • View map

  • Richard Maurer

  • UBMTA

Comments: 

Derived from RSV-PKI constructed by the Maurer lab and described in Day et al., J. Biol. Chem. 264, 431-436, 1989. Altered to add a Kozak consensus translation initiation sequence and also the ori was changed to yield high copy number in E coli.

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 45066" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only