1
Plasmid 45066: pRSV-PKI-v2
  • Expression of PKI (PKA inhibitor)

  • cAMP-dependent protein kinase inhibitor alpha

  • PKI alpha

  • 250

  • Synthetic

  • M23079.1

  • pRSV-link
    (Search Vector Database)

  • Maurer lab

  • Mammalian Expression

  • 4265

  • Backbone derived from pRSV-globin

  • RSV

  • HindIII

  • No

  • NotI

  • No

  • CGATACAATAAACGCCATTTGA List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • View sequences (2)
  • View map

  • Richard Maurer

  • MTA

Comments: 

Derived from RSV-PKI constructed by the Maurer lab and described in Day et al., J. Biol. Chem. 264, 431-436, 1989. Altered to add a Kozak consensus translation initiation sequence and also the ori was changed to yield high copy number in E coli.

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 45066" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only