Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pETCON-DnvLB16
(Plasmid #45124)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45124 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pETCON
  • Backbone size w/o insert (bp) 6287
  • Total vector size (bp) 6644
  • Vector type
    Yeast Expression
  • Selectable markers
    TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DnvLB16
  • Species
    Synthetic
  • Insert Size (bp)
    357
  • Promoter GAL
  • Tags / Fusion Proteins
    • c-myc epitope tag (C terminal on backbone)
    • Aga2p for yeast surface display (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer None
  • 3′ sequencing primer cgagctaaaagtacagtggg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pETCON-DnvLB16 was a gift from David Baker (Addgene plasmid # 45124 ; http://n2t.net/addgene:45124 ; RRID:Addgene_45124)
  • For your References section:

    Computational design of a protein-based enzyme inhibitor. Procko E, Hedman R, Hamilton K, Seetharaman J, Fleishman SJ, Su M, Aramini J, Kornhaber G, Hunt JF, Tong L, Montelione GT, Baker D. J Mol Biol. 2013 Sep 23;425(18):3563-75. doi: 10.1016/j.jmb.2013.06.035. 10.1016/j.jmb.2013.06.035 PubMed 23827138