Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pET29b_Qcat6
(Plasmid #45134)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45134 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET29b
  • Backbone manufacturer
    Genscript
  • Backbone size w/o insert (bp) 5330
  • Total vector size (bp) 6816
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    BLR DE3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    E-coli-pathways-QconCAT6
  • Alt name
    Qcat6
  • Species
    Synthetic
  • Insert Size (bp)
    1486
  • Promoter T7
  • Tag / Fusion Protein
    • 6XHis (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GATCCCGCGAAATTAATACGACTCACTA
  • 3′ sequencing primer GGTGGTGGTGGTGCTCGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Synthesized by Genscript

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET29b_Qcat6 was a gift from Christopher Petzold (Addgene plasmid # 45134 ; http://n2t.net/addgene:45134 ; RRID:Addgene_45134)
  • For your References section:

    A targeted proteomics toolkit for High-throughput absolute quantification of Escherichia coli proteins. Batth TS, Singh P, Ramakrishnan VR, Sousa MM, Chan LJ, Tran HM, Luning EG, Pan EH, Vuu KM, Keasling JD, Adams PD, Petzold CJ. Metab Eng. 2014 Sep 6. pii: S1096-7176(14)00114-1. doi: 10.1016/j.ymben.2014.08.004. 10.1016/j.ymben.2014.08.004 PubMed 25205128