AAV-EF1a-BbTagBY
(Plasmid #45185)

• Depositing Labs: Dawen Cai, Joshua Sanes
• Publication: Cai et al Nat Methods. 2013 May 5;10(6):540-7. doi: 10.1038/nmeth.2450. Epub 2013 May 5.

Backbone

• Vector backbone: pAAV-EF1a-WPRE
• Total vector size (bp): 1700
• Vector type: Mammalian Expression, AAV ; adeno-associated viral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: pAAV-EF1a-Brainbow-invert tagBFP-EYFP-WPRE
• Species: jelly fish and coral fluorescent proteins
• Insert Size (bp): 1700
• Promoter: human EF1a

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: EcoRV (not destroyed)
• 5′ sequencing primer: gatcttggttcattctcaagcctcag
• 3′ sequencing primer: GACTTGGGGAGGGAGTCAGCTGACC

Resource Information

• Supplemental Documents:
  • sequence/map
• A portion of this plasmid was derived from a plasmid made by: cloned by Kim Cohen and Dawen Cai
• Articles Citing this Plasmid:
  • 4 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Information for AAV9 (Catalog # 45185-AAV9)

Purpose

Ready-to-use AAV9 particles produced from AAV-EF1a-BbTagBY (#45185). In addition to the viral particles, you will also receive purified AAV-EF1a-BbTagBY plasmid DNA.

Brainbow construct encoding farnesylated TagBFP and EYFP, both in reverse orientation between mutant Lox sites. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 1×10¹³ vg/mL
• Pricing: $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
• Buffer: PBS + 0.001% Poloxamer 188
• Serotype: AAV9
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: TagBFP, EYFP, or none.

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Ancillary Agreement for Penn Vectors
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Data submitted about 45185-AAV9 by requesting scientist(s):

• Data 1: Rat, Brain parenchyma