Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCI-EGFP-NR2a wt
(Plasmid #45445)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45445 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCI
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4006
  • Total vector size (bp) 10031
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NR2A
  • Alt name
    NMDAR2A
  • Alt name
    GRIN2a
  • Alt name
    GluN2a
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    6000
  • Mutation
    EGFP inserted after the predicted signal peptide cleavage site (after amino acid residue 21)
  • GenBank ID
    D13211.1 BAA02498.1
  • Entrez Gene
    Grin2a (a.k.a. GluN2A, NMDAR2A, NR2A)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (destroyed during cloning)
  • 3′ cloning site SalI (destroyed during cloning)
  • 5′ sequencing primer T7; chim-int-F (TCTTACTGACATCCACTTTGCC)
  • 3′ sequencing primer EBV-rev
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Rat NMDA receptor genes originally cloned by Shigetada Nakanishi (PMID: 1834949)
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCI-EGFP-NR2a wt was a gift from Andres Barria & Robert Malinow (Addgene plasmid # 45445 ; http://n2t.net/addgene:45445 ; RRID:Addgene_45445)
  • For your References section:

    Subunit-specific NMDA receptor trafficking to synapses. Barria A, Malinow R. Neuron. 2002 Jul 18;35(2):345-53. 10.1016/S0896-6273(02)00776-6 PubMed 12160751