Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Tol2 Krt4 Src (YF)-uniRapR-cerulean
(Plasmid #45509)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45509 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pT2KHspGGFF (Asakawa K, Kawakami K. Dev Growth Differ. 2008)
  • Backbone size w/o insert (bp) 9773
  • Total vector size (bp) 13668
  • Modifications to backbone
    T2:Krt4: Src-iFKB-cpFRB-Cer-Myc was constructed by first removing the heat shock promoter from pT2KHspGGFF (Asakawa K, Kawakami K. Dev Growth Differ. 2008) via a ApaI/NcoI digest and replacing it with a ApaI/NcoI fragment containing the Krt4 promoter (Ju B et al. Dev Genet. 1999, Gong et al. 2002. Dev Dyn, genebank GenBank: AF440690.1) which was amplified with (Apa-Krt4 GATGGGCCCCTACAGTAAAGCTTCTCCACAATGTCCCG and NcoI-Krt4 CTACCATGGCTCTGCGTGTCTCTCAGCAGC). Next the GFP-Gal4 fragment was removed with a NcoI/SmaI digest and replaced with the cassette containing Src-iFKB-cpFRB-Cer-Myc which had been removed from PUse via a NcoI/SnaI digest. The final T2:Krt4: Src-iFKB-cpFRB-Cer-Myc contains the Krt4 promoter, the Src-iFKB-cpFRB-Cer-Myc cassette and the polyA signal between Tol2 sequences.
  • Vector type
    zebrafish expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Src (YF)-uniRapR-cerulean
  • Insert Size (bp)
    2988
  • Mutation
    Y732F
  • Promoter krt4
  • Tag / Fusion Protein
    • cerulean (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site Snab1 (destroyed during cloning)
  • 5′ sequencing primer CAAGGGTTGCCATCAAAACT
  • 3′ sequencing primer AAGTCGTGCTGCTTCATGTG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please note that Addgene's sequencing results differ from the full plasmid sequence information from the depositing laboratory at bp# 3150, 3188, 3193, 3199, 3211, 3227, 3307, 5577 & 5578. These differences are not a concern for the function of the plasmid according to the depositing laboratory.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Tol2 Krt4 Src (YF)-uniRapR-cerulean was a gift from Klaus Hahn & Anna Huttenlocher (Addgene plasmid # 45509 ; http://n2t.net/addgene:45509 ; RRID:Addgene_45509)
  • For your References section:

    Rational design of a ligand-controlled protein conformational switch. Dagliyan O, Shirvanyants D, Karginov AV, Ding F, Fee L, Chandrasekaran SN, Freisinger CM, Smolen GA, Huttenlocher A, Hahn KM, Dokholyan NV. Proc Natl Acad Sci U S A. 2013 Apr 23;110(17):6800-4. doi: 10.1073/pnas.1218319110. Epub 2013 Apr 8. 10.1073/pnas.1218319110 PubMed 23569285