This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pDZ513 (pHIS MET25pro PP7-PS-yeGFP)
(Plasmid #45931)


Item Catalog # Description Quantity Price (USD)
Plasmid 45931 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    PP7 coat protein
  • Insert Size (bp)
  • Promoter Met25
  • Tag / Fusion Protein
    • 2x-yeGFP (C terminal on backbone)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer AATGGCACGTGAAGCTGTCG
  • 3′ sequencing primer GGCCGCAAATTAAAGCC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDZ513 (pHIS MET25pro PP7-PS-yeGFP) was a gift from Daniel Zenklusen (Addgene plasmid # 45931 ; ; RRID:Addgene_45931)
  • For your References section:

    Single-molecule analysis of gene expression using two-color RNA labeling in live yeast. Hocine S, Raymond P, Zenklusen D, Chao JA, Singer RH. Nat Methods. 2013 Feb;10(2):119-21. doi: 10.1038/nmeth.2305. Epub 2012 Dec 23. 10.1038/nmeth.2305 PubMed 23263691