Skip to main content

pDR-GFPuniv
(Plasmid #46085)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 46085 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pDR-GFP
  • Backbone manufacturer
    Jasin Lab (Addgene Plasmid# 26475)
  • Modifications to backbone
    modified to accept universal endonuclease target sites
  • Vector type
    Mammalian Expression ; recombination reporter plasmid
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    DR-GFPuniv reporter
  • Alt name
    DRGFPuniv
  • Alt name
    GFP
  • Mutation
    E5G and K163R mutations in EGFP relative to wild-type. EGFP truncated after amino acid 163

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Description: Plasmid for in vivo recombination assays. Based on the original pDR-GFP plasmid described in Pierce et al. GenDev (1999) v13p2633.

Use data: Recipient plasmid for (homing) endonuclease target sites in order to assess in vivo activity of an endonuclease. The plasmid contains two non-functional copies of the eGFP gene: the 5’ copy is interrupted by the target site of interest and stop codons; the 3’ copy is truncated on both 5’- and 3’-end. pDR-GFP as is does not fulfill any other purpose than to receive (homing) endonuclease target sites. The recognition site for the endonuclease of interest must be cloned into the XhoI/SacI sites in the upstream eGFP gene, thus obliterating the XhoI, KpnI and SacI sites. Successful cleavage of the cloned target site generates a DSB. This triggers in vivo a homologous recombination event with the
3’ truncated copy of the eGFP which renders the 5’ copy functional. The activity of a given endonuclease can be measured by the number of GFP+ cells generated. The site that is cloned into pDR-GFP must insert a frameshift into the 5’ eGFP-copy and/or contain a stop codon in frame with the upstream sequence of the eGFP gene to assure that the ORF is not functional and no eGFP can be synthesized prior to the DSB repair event. In order to easily screen for the successful insertion of the oligonucleotide pair representing the site of interest, it is useful to integrate a restriction site that is not present in pDR-GFPuniv (e.g. a PvuII site).

Sample oligonucleotide pair:
oligo1 5’-TCGATAGGGATAACAGGGTAATACAGCTGTAAGCT-3’
oligo2 3’- ATCCCTATTGTCCCATTATGTCGACAT -5’

Please note that this plasmid functions as described in the associated publication and according to the depositing laboratory the changes to the EGFP sequence are not a concern.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDR-GFPuniv was a gift from Raymond Monnat (Addgene plasmid # 46085 ; http://n2t.net/addgene:46085 ; RRID:Addgene_46085)
  • For your References section:

    Comprehensive homing endonuclease target site specificity profiling reveals evolutionary constraints and enables genome engineering applications. Li H, Ulge UY, Hovde BT, Doyle LA, Monnat RJ Jr. Nucleic Acids Res. 2012 Mar;40(6):2587-98. doi: 10.1093/nar/gkr1072. Epub 2011 Nov 25. 10.1093/nar/gkr1072 PubMed 22121229